Sequence 434 (Cthe 1951 , Cthe1951)
From Wikisequences
Sequence Cthe_1951 , Cthe1951 | |
---|---|
Target | Cthe_1951 ( Ruminiclostridium thermocellum ATCC 27405 ) |
Description | |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (20b) AAAATAAAAGCCCAGGATTC / Reverse PCR primer (20b) GCATTATCCTGAAGTTCGTC |
Application | gene expression |
Name | Cthe_1951 , Cthe1951 |
References
Global transcriptome analysis of Clostridium thermocellum ATCC 27405 during growth on dilute acid pretreated Populus and switchgrass.Wilson CM, Rodriguez M Jr, Johnson CM, Martin SL, Chu TM, Wolfinger RD, Hauser LJ, Land ML, Klingeman DM, Syed MH, Ragauskas AJ, Tschaplinski TJ, Mielenz JR, Brown SD.Biotechnol Biofuels. 2013 Dec 2;6(1) :179. doi: 10.1186/1754-6834-6-179.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478