Sequence 449 ()
From Wikisequences
| Sequence | |
|---|---|
| Target | DDB1 ( Homo sapiens ) |
| Description | Damage-specific DNA binding protein 1, 127kDa
Ensembl: ENSG00000167986 UniGene: Hs.290758 EntrezGene: 1642 Ensembl Chr11: 60823510 - 60857153 Strand: -1 GO terms: 0003676 0003684 0005515 0005634 0005737 0006289 0006512 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CCTGTTGATTGCCAAAAACTT / siRNA antisense (21b) GTTTTTGGCAATCAACAGGTT |
| Application | gene silencing |
| Name | |
References
Targeted ubiquitination of CDT1 by the DDB1-CUL4A-ROC1 ligase in response to DNA damage.Hu J, McCall CM, Ohta T, Xiong Y.Nat Cell Biol. 2004 Oct;6(10) :1003-9. Epub 2004 Sep 26.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
