Sequence 44 (M1)

Sequence M1
Target	AGFG1 ( Homo sapiens )
Description	HIV-1 Rev binding protein / ArfGAP with FG repeats 1 Ensembl: ENSG00000173744 UniGene: Hs.591619 , Hs.595484 , Hs.694030 EntrezGene: 5176 Ensembl Chr2: 228045286 - 228130548 Strand: 1 GO terms: 0003677 0003723 0005515 0005634 0005643 0006406 0006810 0007275 0007283 0008270 0030154 0031410 0043087 0046873
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (20b) AGCCCAATCGTGCAGGTTTT / siRNA antisense (20b) AACCTGCACGATTGGGCTTT
Application	gene silencing
Name	M1

References

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Kloss et al. (1998) cloned the doubletime (dbt) gene in Drosophila and noted that it is most closely related to human casein kinase I-epsilon (CSNK1E). Drosophila dbtS and dbtL mutations, which alter period length of Drosophila circadian rhythms, produce single amino acid changes in conserved regions of the predicted kinase. The dbt mRNA appears to be expressed in the same cell types as are Drosophila 'per' (602260) and 'tim.' Dbt is capable of binding to per in vitro and in Drosophila cells, suggesting that a physical association of per and dbt regulates per phosphorylation and accumulation in vivo.

Lowrey et al. (2000) proposed that the shortened period length of circadian rhythms in tau hamsters (see ANIMAL MODEL) arises as a result of the repression of the CLOCK-BMAL1 complex (see 601851) occurring earlier in tau animals relative to wildtype animals. This explains both the observed reduction in, and an earlier appearance of, Per1 mRNA in tau homozygotes in vivo as revealed by in situ hybridization. Lowrey et al. (2000) proposed that CSNK1E plays a significant role in delaying the negative feedback signal within the transcription-translation-based autoregulatory loop that composes the core of the circadian mechanism. They suggested that since CSNK1E is an enzyme, it makes an ideal target for pharmaceutical compounds influencing circadian rhythms, sleep, and jet lag, as well as other physiologic and metabolic processes under circadian regulation.

Casein kinase I-epsilon has a prominent role in regulating the phosphorylation and abundance of Per proteins in animals. Using a Drosophila cell culture system, Ko et al. (2002) demonstrated that the doubletime gene, the Drosophila homolog of CKI-epsilon, promotes the progressive phosphorylation of Per, leading to the rapid degradation of hyperphosphorylated isoforms by the ubiquitin-proteasome pathway. Slimb (603482), an F-box/WD40-repeat protein functioning in the ubiquitin-proteasome pathway, interacts preferentially with phosphorylated Per and stimulates its degradation. Overexpression of slimb or expression in clock cells of a dominant-negative version of slimb disrupts normal rhythmic activity in flies. Ko et al. (2002) concluded that hyperphosphorylated Per is targeted to the proteasome by interactions with Slimb.

Using mathematical modeling, Vanselow et al. (2006) predicted that differential PER phosphorylation events could result in opposite period phenotypes, and studies in oscillating fibroblasts confirmed that interference with specific aspects of Per2 (603426) phosphorylation leads to either short or long periods. Vanselow et al. (2006) concluded that this concept explains not only the FASPS phenotype (604338), but also the effect of the tau mutation in hamster and doubletime mutations in Drosophila.

Using Drosophila cells and various Per mutants, Chiu et al. (2011) found that Per was progressively phosphorylated by doubletime and the proline-directed serine kinase Nemo (IKBKG; 300248). Per phosphorylation began at a specific cluster of serines at the beginning of the circadian cycle, with additional phosphorylation of Per by doubletime at more distant sites as the cycle progressed. Animal Model.The tau mutation is a semidominant autosomal allele that dramatically shortens period length of circadian rhythms in Syrian hamsters. Lowrey et al. (2000) reported the molecular identification of the tau locus using genetically directed representational difference analysis to define a region of conserved synteny in hamsters with both the mouse and human genomes. The tau locus is encoded by CSNK1E, a homolog of the Drosophila circadian gene doubletime (dbt). In vitro expression and functional studies of wildtype and tau mutant CSNK1E enzyme revealed that the mutant enzyme has a markedly reduced maximum velocity and autophosphorylation state. In addition, in vitro CSNK1E can interact with mammalian PERIOD proteins, and the mutant enzyme is deficient in its ability to phosphorylate PERIOD. Lowrey et al. (2000) concluded that tau is an allele of hamster Csnk1e and proposed a mechanism by which the mutation leads to the observed aberrant circadian phenotype in mutant animals.

Meng et al. (2008) generated a mouse model of the Csnk1e tau mutant and observed that the mutation shortened the circadian period of behavior in a dose-dependent manner, but acted as a gain-of-function mutation. Csnk1e-null mice showed a small yet significant lengthening of the circadian period compared to wildtype (24.0 vs 23.6 hours, respectively). Mice heterozygous for the null allele behaved similarly to wildtype. Asymmetric oxygen consumption data suggested that the tau mutation may accelerate the period by specifically compressing the inactive phase of the cycle. Recordings of suprachiasmatic neurons isolated from the various mutants showed a significant correlation between firing rate rhythms and behavior. Cells from the tau mutants showed accelerated firing compared to wildtype, although gene loss did not alter the fundamental electrophysiologic properties of suprachiasmatic neurons. The tau mutation acted by promoting the degradation of Per1 (602260) and Per2 (603426) in the early circadian night. The tau mutation also accelerated the molecular dynamics of circadian time-keeping in peripheral tissues, indicating that it plays a global role in the organism.