Sequence 452 (ISIS-327822 , ISIS 327822)
From Wikisequences
| Sequence ISIS-327822 , ISIS 327822 | |
|---|---|
| Target | Dgat1 ( Rattus norvegicus ) |
| Description | Diacylglycerol O-acyltransferase 1
Ensembl: ENSRNOG00000028711 UniGene: Rn.252 EntrezGene: 84497 |
| Design | MOE gapmer |
| Chemistry | moC*moC*moT*moT*moC*G*C*T*G*G*C*G*G*C*A*moC*moC*moA*moC*moA |
| Sequence | CCTTCGCTGGCGGCACCACA |
| Application | gene silencing |
| Name | ISIS-327822 , ISIS 327822 |
References
Suppression of diacylglycerol acyltransferase-2 (DGAT2), but not DGAT1, with antisense oligonucleotides reverses diet-induced hepatic steatosis and insulin resistance. Choi CS, Savage DB, Kulkarni A, Yu XX, Liu ZX, Morino K, Kim S, Distefano A, Samuel VT, Neschen S, Zhang D, Wang A, Zhang XM, Kahn M, Cline GW, Pandey SK, Geisler JG, Bhanot S, Monia BP, Shulman GI. J Biol Chem. 2007 Aug 3;282(31):22678-88.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
