Sequence 453 (ISIS-369235 , ISIS 369235)
| Sequence ISIS-369235 , ISIS 369235 | |
|---|---|
| Target | Dgat2 ( Rattus norvegicus ) |
| Description | Diacylglycerol O-acyltransferase homolog 2 ( mouse )
Ensembl: ENSRNOG00000016573 UniGene: Rn.9523 EntrezGene: 252900 Ensembl Chr1: 156447588 - 156515241 Strand: -1 GO terms: 0003846 0004144 0005783 0006071 0006629 0008415 0008610 0016020 0016021 0016740 |
| Design | MOE gapmer |
| Chemistry | moG*moC*moA*moT*moT*A*C*C*A*C*T*C*C*C*A*moT*moT*moC*moT*moT |
| Sequence | GCATTACCACTCCCATTCTT |
| Application | gene silencing |
| Name | ISIS-369235 , ISIS 369235 |
References
Suppression of diacylglycerol acyltransferase-2 (DGAT2), but not DGAT1, with antisense oligonucleotides reverses diet-induced hepatic steatosis and insulin resistance. Choi CS, Savage DB, Kulkarni A, Yu XX, Liu ZX, Morino K, Kim S, Distefano A, Samuel VT, Neschen S, Zhang D, Wang A, Zhang XM, Kahn M, Cline GW, Pandey SK, Geisler JG, Bhanot S, Monia BP, Shulman GI. J Biol Chem. 2007 Aug 3;282(31):22678-88.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
