Sequence 45 (H2)

Sequence H2
Target	AGFG1 ( Homo sapiens )
Description	HIV-1 Rev binding protein / ArfGAP with FG repeats 1 Ensembl: ENSG00000173744 UniGene: Hs.591619 , Hs.595484 , Hs.694031 EntrezGene: 5177 Ensembl Chr2: 228045286 - 228130548 Strand: 1 GO terms: 0003677 0003723 0005515 0005634 0005643 0006406 0006810 0007275 0007283 0008270 0030154 0031410 0043087 0046874
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (20b) TGGCTTTGGGACCACAGGTT / siRNA antisense (20b) CCTGTGGTCCCAAAGCCATT
Application	gene silencing
Name	H2

References

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. The CSNK1D gene encodes an isoform of casein kinase I, which is a ubiquitous serine/threonine-specific protein kinase that constitutes most of the kinase activity in eukaryotic cells, where it is distributed in the nucleus, cytoplasm, and membrane fractions (summary by Kusuda et al., 1996). CSNK1D is enriched in the brain (summary by Zhou et al., 2010). Gene Function. Lord et al. (2011) used a yeast transport assay to demonstrate that an endoplasmic reticulum (ER)-derived vesicle retains its coat until it reaches the Golgi. A Golgi-associated kinase, Hrr25p, which is a CKI-delta ortholog, then phosphorylates the Sec23p (see 610511)/Sec24p (see 607183) complex. Coat phosphorylation and dephosphorylation are needed for vesicle fusion and budding, respectively. Additionally, Lord et al. (2011) showed that Sec23p interacts in a sequential manner with different binding partners, including the tethering factor complex TRAPPI (see 610397) and Hrr25p, to ensure the directionality of ER-Golgi traffic and prevent the back-fusion of a COPII vesicle with the ER. Lord et al. (2011) stated that these events are conserved in mammalian cells.

Molecular Genetics. Zhou et al. (2010) found that mice with targeted overexpression of the Csnk1d gene in the forebrain and striatum exhibited hyperactivity, decreased anxiety, increased impulsivity, and defects in nesting behavior compared to wildtype mice. Mutant mice also showed paradoxical responses to dopamine receptor stimulation, showing hypoactivity following injection of amphetamine or methylphenidate and certain dopamine agonists. Csnk1d overexpression was also associated with downregulation of DRD1 (126449) and DRD2 (126450) receptor levels. The behavioral characteristics in these mice were reminiscent of the symptoms and drug responses observed in attention deficit-hyperactivity disorder (ADHD; 143465) in humans. Animal Model.Zhou et al. (2010) found that mice with targeted overexpression of the Csnk1d gene in the forebrain and striatum exhibited hyperactivity, decreased anxiety, increased impulsivity, and defects in nesting behavior compared to wildtype mice. Mutant mice also showed paradoxical responses to dopamine receptor stimulation, showing hypoactivity following injection of amphetamine or methylphenidate and certain dopamine agonists. Csnk1d overexpression was also associated with downregulation of DRD1 (126449) and DRD2 (126450) receptor levels. The behavioral characteristics in these mice were reminiscent of the symptoms and drug responses observed in attention deficit-hyperactivity disorder (ADHD; 143465) in humans.