Sequence 462 (ri1)

Sequence ri1
Target	Dnaja3 ( Mus musculus )
Description	DnaJ ( Hsp40 ) homolog, subfamily A, member 3 Ensembl: ENSMUSG00000004069 UniGene: Mm.458112 EntrezGene: 83945 Ensembl Chr16: 4684123 - 4707691 Strand: 1 GO terms: 0005083 0005634 0005739 0005759 0005829 0006457 0006915 0007264 0008270 0031072 0046872 0051082
Design	shRNA
Chemistry	RNA
Sequence	(49b) GTGCTTCTTTGGCCAAAGATTCAAGAGATCTTTGGCCAAAGAAGCACTT
Application	gene silencing
Name	ri1

References

Functional genetic screen for genes involved in senescence: role of Tid1, a homologue of the Drosophila tumor suppressor l(2) tid, in senescence and cell survival.Tarunina M, Alger L, Chu G, Munger K, Gudkov A, Jat PS.Mol Cell Biol. 2004 Dec;24(24) :10792-801.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background