Sequence 465 (ri6)
From Wikisequences
Sequence ri6 | |
---|---|
Target | Dnaja3 ( Mus musculus ) |
Description | DnaJ ( Hsp40 ) homolog, subfamily A, member 3
Ensembl: ENSMUSG00000004069 UniGene: Mm.458112 EntrezGene: 83945 Ensembl Chr16: 4684123 - 4707691 Strand: 1 GO terms: 0005083 0005634 0005739 0005759 0005829 0006457 0006915 0007264 0008270 0031072 0046872 0051082 |
Design | shRNA |
Chemistry | RNA |
Sequence | (49b) GCAAGGATAGGCGAGAGGCTTCAAGAGAGCCTCTCGCCTATCCTTGCTT |
Application | gene silencing |
Name | ri6 |
References
Functional genetic screen for genes involved in senescence: role of Tid1, a homologue of the Drosophila tumor suppressor l(2) tid, in senescence and cell survival.Tarunina M, Alger L, Chu G, Munger K, Gudkov A, Jat PS.Mol Cell Biol. 2004 Dec;24(24) :10792-801.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478