Sequence 467 (D1)

Sequence D1
Target	DNM1L ( Homo sapiens )
Description	Dynamin 1-like Ensembl: ENSG00000087470
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) TCCGTGATGAGTATGCTTTTT / siRNA antisense (21b) AAAGCATACTCATCACGGATT
Application	gene silencing
Name	D1

References

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. DNM1L belongs to the dynamin (see DNM1; 602377) family of large GTPases that mediate membrane remodeling during a variety of cellular processes. DNM1L has an important role in the division of growing mitochondria and peroxisomes (summary by Pitts et al. (2004)). Gene Function. To determine the function of DRP1 (DNM1L), Smirnova et al. (1998) expressed mutant DRP1 in COS-7 cells. A mutation in the GTPase domain caused profound alterations in mitochondrial morphology. In cells expressing mutant DRP1, the tubular projections normally present in wildtype cells were retracted into large perinuclear aggregates. By electron microscopy, the mitochondrial aggregates appeared as clusters of tubules rather than as a large mass of coalescing membrane. The morphology of other organelles was unaffected by mutant DRP1. In addition, mutant DRP1 had no effect on the transport functions of the secretory and endocytic pathways. The authors proposed that DRP1 establishes mitochondrial morphology through a role in distributing mitochondrial tubules throughout the cytoplasm. They suggested that DRP1 is the functional equivalent of yeast Dnm1.

Imoto et al. (1998) demonstrated that overexpression of wildtype human DRP1 in mammalian cells increased secretion of a luciferase reporter protein, whereas overexpression of a GTP-binding site mutant of DRP1 decreased secretion of this marker.

Using an in vitro GTPase assay, Kamimoto et al. (1998) showed that a bacterially expressed DYMPLE fusion protein hydrolyzed GTP without additive modifications or coactivators.

Hong et al. (1998) showed that the C-terminal region of the 699-amino acid DYNIV protein bound to GSK3B.

Shin et al. (1999) found that DNM1L was oligomeric, probably tetrameric, under physiologic salt conditions, and that it aggregated into sedimentable complexes under low salt conditions. Analyses using the yeast 2-hybrid system and immunoprecipitation showed that the N-terminal and C-terminal regions of DNM1L could interact with each other. Animal Model.Ishihara et al. (2009) found that Drp1 deletion in mice was embryonic lethal. Drp1 -/- embryos showed reduced development of the heart and liver, as well as thinned neural tube cell layer. Electron microscopy revealed that Drp1 -/- embryos had enlarged mitochondria with normal cristae and cytochrome c oxidase (see 516030) activity. Embryonic fibroblasts and stem cells from Drp1 -/- mice were healthy and proliferated normally. The ER and Golgi of Drp1 -/- cells appeared normal, but their mitochondria were abnormally extended and clustered near the nucleus. Peroxisomes were also swollen in Drp1 -/- cells. Cytokinesis in Drp1 -/- fibroblasts proceeded asymmetrically, with filamentous and highly clustered mitochondria cleaved at a constriction site of the cell in concert with cytokinesis and segregated unequally into the daughter cells. Treatment of Drp1 -/- cells with proapoptotic reagents suggested that Drp1 is involved in later apoptotic events, including cytochrome c release and caspase activation. Mice with neural cell-specific Drp1 deletion (NS-Drp1 -/- mice) died shortly after birth as a result of brain hypoplasia and apoptosis. Primary cultures of NS-Drp1 -/- mouse forebrain showed decreased number of neurites and defective synapse formation, suggesting that aggregated mitochondria fail to distribute properly within neural cell processes. NS-Drp1 -/- neuronal cells were also highly sensitive to Ca(2+)-dependent apoptosis.