Sequence 46 (M2)
| Sequence M2 | |
|---|---|
| Target | AGFG1 ( Homo sapiens ) |
| Description | HIV-1 Rev binding protein / ArfGAP with FG repeats 1
Ensembl: ENSG00000173744 UniGene: Hs.591619 , Hs.595484 , Hs.694032 EntrezGene: 5178 Ensembl Chr2: 228045286 - 228130548 Strand: 1 GO terms: 0003677 0003723 0005515 0005634 0005643 0006406 0006810 0007275 0007283 0008270 0030154 0031410 0043087 0046875 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (20b) TGGCTTCGGGACCACAGGTT / siRNA antisense (20b) CCTGTGGTCCCGAAGCCATT |
| Application | gene silencing |
| Name | M2 |
References
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. By yeast 2-hybrid analysis and coimmunoprecipitation studies in mouse fibroblast cells (NIH3T3) and HeLa cells, Mannan et al. (2006) demonstrated that reticulon-1 interacts with spastin (SPAST; 604277), which is mutated in hereditary spastic paraplegia-4 (SPG4; 182601). The interaction is mediated through the spastin N-terminal region, which contains a microtubule-interacting and trafficking domain. Intracellular distribution studies showed colocalization of the 2 proteins in discrete cytoplasmic vesicles. The findings strengthened the hypothesis that disruption of intracellular vesicular transport processes may underlie spastic paraplegia. Mannan et al. (2006) failed to identify mutations in the coding or flanking intronic sequences of the RTN1 gene in 2 index patients from families with SPG15 (270700), which had been mapped to chromosome 14q.
