Sequence 479 (mERAAP)

Sequence mERAAP
Target	Erap1 ( Mus musculus )
Description	Endoplasmic reticulum aminopeptidase 1 Ensembl: ENSG00000164307 UniGene: Hs.436186 EntrezGene: 51752 Ensembl Chr5: 96122270 - 96169648 Strand: -1 GO terms: 0001525 0004178 0004179 0004239 0005138 0005151 0005515 0005576 0005737 0005783 0005788 0005829 0006508 0006509 0008217 0008237 0008270 0016021 0019885 0045088 0045444 0045766 0046872
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) AGCTAGTAATGGAGACTCATT / siRNA antisense (21b) TGAGTCTCCATTACTAGCTTT
Application	gene silencing
Name	mERAAP

References

ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum.Serwold T, Gonzalez F, Kim J, Jacob R, Shastri N.Nature. 2002 Oct 3;419(6906) :480-3.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Aminopeptidases play a role in the metabolism of several peptides that may be involved in blood pressure and the pathogenesis of essential hypertension (145500). Adipocyte-derived leucine aminopeptidase (ALAP) is a member of the M1 family of zinc metallopeptidases.Gene Function. By yeast 2-hybrid analysis and by coimmunoprecipitation experiments, Cui et al. (2002) found that human ARTS1 bound to the extracellular domain of TNFR1 (191190). Overexpression of ARTS1 resulted in increased TNFR1 shedding and decreased membrane-associated TNFR1. Reducing the membrane levels of ARTS1 by expression of antisense ARTS1 mRNA had the opposite effect. Recombinant ARTS1 demonstrated selective aminopeptidase activity toward nonpolar amino acids, but it had no activity against TNFR1 and was not the TNFR1 sheddase. ARTS1 neither bound to TNFR2 (191191) nor altered its shedding, suggesting specificity for TNFR1. Cui et al. (2002) concluded that formation of the TNFR1-ARTS1 molecular complex represents a novel mechanism by which TNFR1 shedding is regulated.

Saric et al. (2002) and York et al. (2002) determined that purified ERAP1 trims peptides greater than 10 residues in length, but it spares and enhances the production of 8-residue peptides generated either in the ER or cytosol. ERAP1 was also found to trim nearly half of 9-residue peptides, thereby reducing the supply of antigenic peptides in the absence of IFNG expression, which induces ERAP1 expression and instead causes proteasomes to produce more N-terminally extended antigenic precursors and 9-residue peptides.

Using fractionated ER contents to test for aminopeptidase activity, Saveanu et al. (2005) found that ERAP1 and ERAP2 (609497) copurified. Confocal microscopy confirmed colocalization of ERAP1 and ERAP2 in the ER. Immunoprecipitation experiments suggested that ERAP1 and ERAP2 form heterodimers. Enzymatic analysis showed that ERAP2 preferentially hydrolyzed the basic residues arg and lys, whereas ERAP1 acted on leu. Trimming did not continue after production of minimal nonamer epitopes. Saveanu et al. (2005) concluded that ERAP1 and ERAP2 function in a complementary manner on peptides with 9 or more residues.

Using synthetic peptides and natural antigenic precursors, Chang et al. (2005) showed that ERAP1 preferred substrates of the same lengths (9 to 16 residues) as those transported by TAP. Like most MHC class I molecules, ERAP1 preferred peptides with hydrophobic C-terminal amino acids. Chang et al. (2005) concluded that these properties, particularly its 'molecular ruler' mechanism of binding hydrophobic C termini 9 to 16 residues from the active site, distinguish ERAP1 from other aminopeptidases. They proposed that ERAP1 evolved to facilitate antigen presentation.

Molecular GeneticsAnimal Model.York et al. (2006) generated fertile, healthy mice lacking Erap1. MHC class I levels were reduced in Erap1 -/- splenocytes, but not fibroblasts, and peptide trimming in Erap1 -/- fibroblasts was reduced. The immune response in Erap1 -/- mice to some viral peptides was altered due to lack of the trimming enzyme.