Sequence 47 (H3)
Sequence H3 | |
---|---|
Target | AGFG1 ( Homo sapiens ) |
Description | HIV-1 Rev binding protein / ArfGAP with FG repeats 1
Ensembl: ENSG00000173744 UniGene: Hs.591619 , Hs.595484 , Hs.694033 EntrezGene: 5179 Ensembl Chr2: 228045286 - 228130548 Strand: 1 GO terms: 0003677 0003723 0005515 0005634 0005643 0006406 0006810 0007275 0007283 0008270 0030154 0031410 0043087 0046876 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GCCAAAGTCCTGGCATCAGTT / siRNA antisense (21b) CTGATGCCAGGACTTTGGCTT |
Application | gene silencing |
Name | H3 |
References
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. BCL6 (109565) encodes a Kruppel-type zinc finger transcriptional repressor. Rearrangements of this gene are frequent in various kinds of lymphomas, particularly of the large-cell B-cell type. The BCL6 nuclear phosphoprotein is expressed in a variety of tissues and is upregulated particularly in lymph node germinal centers. The zinc fingers of BCL6 bind DNA in a sequence-specific manner. To identify targets of the BCL6 repressive effects, Baron et al. (2002) used a fusion protein of BCL6 and an activating domain of herpes simplex virus containing the zinc fingers but devoid of the repressor domains to compete with the binding of endogenous BCL6 in a transiently transfected B-cell line and then performed subtractive hybridization to selectively amplify sequences that are differentially expressed. They found that the PDCD2 gene is a target of BCL6 repression. As noted, PDCD2 is the human homolog of Rp8, a rat gene associated with programmed cell death in thymocytes. Immunohistochemistry demonstrated the anticipated inverse relationship between BCL6 and PDCD2 expression in human tonsils. The results raised the possibility that BCL6 may regulate apoptosis by means of its repressive effects on PDCD2. BCL6 deregulation may lead to persistent downregulation of PDCD2, reduced apoptosis, and, as a consequence, accumulation of BCL6-containing lymphoma cells.
Using EMSA, Baron et al. (2007) showed that BCL6 bound directly to the PDCD2 promoter and repressed its transcription. Small interfering RNA-mediated knockdown of BCL6 in a B-cell lymphoma line resulted in increased PDCD2 protein expression. Mice overexpressing human BCL6 had minimal Pdcd2. Immunohistochemical analysis demonstrated an inverse relationship of PDCD2 and BCL6 expression in human B and T lymphomas. Baron et al. (2007) concluded that PDCD2 is a target of BCL6 and that PDCD2 repression by BCL6 is important in the pathogenesis of certain human lymphomas.