Sequence 531 (fluv)
From Wikisequences
Sequence fluv | |
---|---|
Target | fluv ( Photinus pyralis ) |
Description | |
Design | shRNA |
Chemistry | RNA |
Sequence | (49b) CATTATCCTCTAGAGGATGTTCAAGAGACATCCTCTAGAGGATAATGTT |
Application | gene silencing |
Name | fluv |
References
Specific inhibition of HIV-1 replication by short hairpin RNAs targeting human cyclin T1 without inducing apoptosis.Li Z, Xiong Y, Peng Y, Pan J, Chen Y, Wu X, Hussain S, Tien P, Guo D.FEBS Lett. 2005 Jun 6;579(14) :3100-6.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478