Sequence 537 (SytIX-2 , SytIX2)
Sequence SytIX-2 , SytIX2 | |
---|---|
Target | FZR1 ( Homo sapiens ) |
Description | Fizzy/cell division cycle 20 related 1 ( Drosophila )
Ensembl: ENSG00000105325 UniGene: Hs.413133 EntrezGene: 51343 Ensembl Chr19: 3473954 - 3489325 Strand: 1 GO terms: 0000074 0005515 0005634 0005680 0005737 0006511 0006512 0007049 0007067 0008047 0051301 |
Design | shRNA |
Chemistry | RNA |
Sequence | (49b) CCACCATTAAGAAGAACACTTCAAGAGAGTGTTCTTCTTAATGGTGGTT |
Application | gene silencing |
Name | SytIX-2 , SytIX2 |
References
RNA interference-mediated silencing of synaptotagmin IX, but not synaptotagmin I, inhibits dense-core vesicle exocytosis in PC12 cells.Fukuda M.Biochem J. 2004 Jun 15;380(Pt 3) :875-9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. By Western blot analysis of a synchronized mouse fibroblast cell line, Listovsky et al. (2004) found that the level of Hcdh reached a minimum in late G1 of the cell cycle. Hcdh was phosphorylated from S phase to mitosis, which inhibited its activation of APC/C. Listovsky et al. (2004) found that Hcdh levels were reduced by degradation in G1 and G0. APC/C-specific degradation depended upon 2 RxxL-type D boxes in the Hcdh sequence and was autoregulated by Hcdh binding to APC/C. Hcdh was not a substrate for APC/C-Cdc20. Listovsky et al. (2004) concluded that autoregulation of HCDH would assure that the level of HCDH is reduced during G1 and G0.
Using crosslinking to stabilize transient interactions between APC/C and its substrates in HeLa cells, Kraft et al. (2005) determined that the D boxes of substrate proteins interacted with the WD40 domain of HCDH and that these interactions were essential for substrate ubiquitination. HCDH specifically crosslinked to the CDC27 (116946) subunit of APC/C. Kraft et al. (2005) hypothesized that the propeller-shaped WD40 domain of HCDH functions as the receptor for D-box substrates, which are recruited to APC/C via the interaction between HCDH and CDC27.
Dube et al. (2005) obtained 3-dimensional models of the human and Xenopus APC. They mapped CDH1 and APC2 (ANAPC2; 606946) to the same side of APC, implying that this is where substrates are ubiquitinated. Dube et al. (2005) identified a large flexible domain in the complex that adopts a different orientation upon CDH1 binding, suggesting that CDH1 may activate the complex both by recruiting substrates and by inducing conformational changes.