Sequence 540 (GABBR1)
From Wikisequences
Sequence GABBR1 | |
---|---|
Target | GABBR1 ( Homo sapiens ) |
Description | Gamma-aminobutyric acid ( GABA ) B receptor, 1
Ensembl: ENSG00000204681 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) TATTGGTTCCTGGGCTGCTTT / siRNA antisense (21b) AGCAGCCCAGGAACCAATATT |
Application | gene silencing |
Name | GABBR1 |
References
Identification of cell surface targets for HIV-1 therapeutics using genetic screens.Dunn SJ, Khan IH, Chan UA, Scearce RL, Melara CL, Paul AM, Sharma V, Bih FY, Holzmayer TA, Luciw PA, Abo A.Virology. 2004 Apr 10;321(2) :260-73.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478