Sequence 542 (GFP)
From Wikisequences
Sequence GFP | |
---|---|
Target | GFP |
Description | |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) CGAGAAGCGCGATCACATGTT / siRNA antisense (21b) CATGTGATCGCGCTTCTCGTT |
Application | gene silencing |
Name | GFP |
References
Proteolysis of DNA replication licensing factor Cdt1 in S-phase is performed independently of geminin through its N-terminal region.Nishitani H, Lygerou Z, Nishimoto T.J Biol Chem. 2004 Jul 16;279(29) :30807-16. Epub 2004 May 11.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478