Sequence 552 (siGSK3B.2)
| Sequence siGSK3B.2 | |
|---|---|
| Target | GSK3B (Homo sapiens) |
| Description | Glycogen synthase kinase 3 beta
Ensembl: ENSG00000082701 UniGene: Hs.445733 EntrezGene: 2932 Ensembl Chr3: 121028238 - 121295203 Strand: -1 GO terms: 0000166 0002039 0004672 0004674 0004696 0004713 0005524 0005634 0005737 0005977 0006468 0006983 0007242 0016740 0018105 0030877 0042309 0043066 0046827 0050825 0050826 0051059 0060070 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CACTGGTCACGTTTGGAAATT / siRNA antisense (21b) TTTCCAAACGTGACCAGTGTT |
| Application | gene silencing |
| Name | siGSK3B.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
