Sequence 553 (beta-globin , betaglobin)
From Wikisequences
| Sequence beta-globin , betaglobin | |
|---|---|
| Target | HBB ( Homo sapiens ) |
| Description | Hemoglobin, beta
Ensembl: ENSG00000244734 UniGene: Hs.523443 EntrezGene: 3043 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CAAGAAAGTGCTCGGTGCCTT / siRNA antisense (21b) GGCACCGAGCACTTTCTTGTT |
| Application | gene silencing |
| Name | beta-globin , betaglobin |
References
Roles of AUF1 isoforms, HuR and BRF1 in ARE-dependent mRNA turnover studied by RNA interference.Raineri I, Wegmueller D, Gross B, Certa U, Moroni C.Nucleic Acids Res. 2004 Feb 19;32(4) :1279-88. Print 2004.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
