Sequence 556 (ISIS HuASOEx1)
Sequence ISIS HuASOEx1 | |
---|---|
Target | HTT ( Homo sapiens ) |
Description | Huntingtin ( Huntington disease )
Ensembl: ENSG00000197386 UniGene: Hs.518450 EntrezGene: 3064 Ensembl Chr4: 3046206 - 3215485 Strand: 1 GO terms: 0003714 0005215 0005246 0005515 0005625 0005634 0005737 0005794 0006915 0006916 0006917 0007610 0008017 0009405 0009887 0009952 0016023 0016234 0047496 0048341 |
Design | MOE gapmer |
Chemistry | moG*moC*moA*moG*moG*G*T*T*A*C*C*G*C*C*A*moT*moC*moC*moC*moC |
Sequence | GCAGGGTTACCGCCATCCCC |
Application | gene silencing |
Name | ISIS HuASOEx1 |
References
Sustained therapeutic reversal of Huntington's disease by transient repression of huntingtin synthesis. Kordasiewicz HB, Stanek LM, Wancewicz EV, Mazur C, McAlonis MM, Pytel KA, Artates JW, Weiss A, Cheng SH, Shihabuddin LS, Hung G, Bennett CF, Cleveland DW.Neuron. 2012 Jun 21;74(6):1031-44.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478