Sequence 562 (si 090)

Sequence si_090
Target	HDAC6 ( Homo sapiens )
Description	Histone deacetylase 6 Ensembl: ENSG00000094631 UniGene: Hs.6764 EntrezGene: 10013 Ensembl ChrX: 48545170 - 48568336 Strand: 1 GO terms: 0000118 0000209 0003779 0004407 0005515 0005634 0005737 0005874 0006350 0006355 0006476 0007026 0007049 0007275 0008270 0016566 0016568 0016575 0016787 0042826 0042903 0046872
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GGTGTTGGATGAGCAGTTAAA / siRNA antisense (21b) TAACTGCTCATCCAACACCAA
Application	gene silencing
Name	si_090

References

DSIR: assessing the design of highly potent siRNA by testing a set of cancer-relevant target genes. Filhol O, Ciais D, Lajaunie C, Charbonnier P, Foveau N, Vert JP, Vandenbrouck Y. PLoS One. 2012;7(10):e48057.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Histone acetylation (see HAT1; 603053) and deacetylation (see HDAC1; 601241) alternately exposes and occludes DNA to transcription factors. There are at least 2 classes of HDACs, class I consisting of proteins homologous to yeast Rpd3 (e.g., HDAC1, HDAC2 (605164), and HDAC3 (605166)) and class II consisting of proteins homologous to yeast Hda1 (e.g., HDAC4; 605314). HDAC6 belongs to class II.Gene Function. Hubbert et al. (2002) demonstrated that HDAC6 functions as a tubulin deacetylase. HDAC6 is localized exclusively in the cytoplasm, where it associates with microtubules and localizes with the microtubule motor complex (see 601143). In vivo the overexpression of HDAC6 led to a global deacetylation of alpha-tubulin (see 602529), whereas a decrease in HDAC6 increased alpha-tubulin acetylation. In vitro, purified HDAC6 potently deacetylated alpha-tubulin in assembled microtubules. Furthermore, overexpression of HDAC6 promoted chemotactic cell movement, supporting the idea that HDAC6-mediated deacetylation regulates microtubule-dependent cell motility. Hubbert et al. (2002) concluded that HDAC6 is the tubulin deacetylase, and provided evidence that reversible acetylation regulates important biologic processes beyond histone metabolism and gene transcription.

Aggregates of misfolded proteins are transported and removed from the cytoplasm by dynein motors via the microtubule network to an organelle termed the aggresome, where they are processed. Kawaguchi et al. (2003) identified HDAC6 as a component of the aggresome in human cells. HDAC6 could bind both polyubiquitinated misfolded proteins and dynein motors, thereby recruiting misfolded protein cargo to dynein motors for transport to aggresomes. Cells deficient in HDAC6 failed to clear misfolded protein aggregates from the cytoplasm, could not form aggresomes properly, and were hypersensitive to accumulation of misfolded proteins.

Bertos et al. (2004) determined that the SE14 domain of HDAC6 was dispensable for the deacetylase and ubiquitin-binding activities of HDAC6, but it conferred acetyl-microtubule targeting. They further found that HDAC6 maintained a cytoplasmic distribution in the presence of leptomycin B, an inhibitor of nuclear export signals, and that the SE14 domain conferred leptomycin B resistance. The SE14 domain formed a unique structure that caused monomeric HDAC6 to migrate at a molecular mass of about 500 kD by gel filtration, rather than the predicted mass of about 150 kD. Bertos et al. (2004) concluded that the cytoplasmic distribution of HDAC6 is differentially regulated in mice and humans, and that the SE14 domain serves to stably retain human HDAC6 in the cytoplasm.

Kovacs et al. (2005) found that inactivation of HDAC6 in human embryonic kidney cells led to HSP90 (see 140571) hyperacetylation, dissociation of HSP90 from an essential cochaperone, p23 (607061), and loss of chaperone activity. In HDAC6-deficient cells, HSP90-dependent maturation of the glucocorticoid receptor (GCCR; 138040) was compromised, resulting in a receptor defective in ligand binding, nuclear translocation, and transcriptional activation. Kovacs et al. (2005) concluded that HSP90 is a target of HDAC6 and that reversible acetylation is a mechanism that regulates HSP90 chaperone complex activity.

Pandey et al. (2007) demonstrated in Drosophila that autophagy acts as a compensatory degradation system when the ubiquitin proteasome system (UPS) is impaired, and that HDAC6, a microtubule-associated deacetylase that interacts with polyubiquitinated proteins, is an essential mechanistic link in this compensatory interaction. The authors found that compensatory autophagy was induced in response to mutations affecting the proteasome and in response to UPS impairment in a fly model of the neurodegenerative disease spinobulbar muscular atrophy. Autophagy compensated for impaired UPS function in an HDAC6-dependent manner. Furthermore, expression of HDAC6 was sufficient to rescue degeneration associated with UPS dysfunction in vivo in an autophagy-dependent manner. Pandey et al. (2007) concluded that impairment of autophagy (i.e., associated with aging or genetic variation) might predispose to neurodegeneration. Moreover, their findings suggested that it may be possible to intervene in neurodegeneration by augmenting HDAC6 to enhance autophagy.