Sequence 585 (cont)

Sequence cont
Target	HDAC8 ( Homo sapiens )
Description	Histone deacetylase 8 Ensembl: ENSG00000147099 UniGene: Hs.310536 EntrezGene: 55869 Ensembl ChrX: 71466091 - 71709623 Strand: -1 GO terms: 0000118 0000122 0000228 0004407 0005634 0005737 0006333 0006350 0006355 0008134 0016568 0016575 0016787
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) ACAGAACCACGAGAGGTGGTT / siRNA antisense (21b) CCACCTCTCGTGGTTCTGTTT
Application	gene silencing
Name	cont

References

Role of cyclophilin B in activation of interferon regulatory factor-3.Obata Y, Yamamoto K, Miyazaki M, Shimotohno K, Kohno S, Matsuyama T.J Biol Chem. 2005 May 6;280(18) :18355-60. Epub 2005 Mar 10.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Histone acetylation (see HAT1; 603053) and deacetylation (see HDAC1; 601241) alternately exposes and occludes DNA to transcription factors. There are at least 2 classes of HDACs, class I consisting of proteins homologous to yeast Rpd3 (e.g., HDAC1, HDAC2 (605164), and HDAC3 (605166)) and class II consisting of proteins homologous to yeast Hda1 (e.g., HDAC4; 605314).Gene Function. Hu et al. (2000) demonstrated that HDAC8 expresses deacetylation activity in nuclear extracts as well as with histones H3 and H4; this activity could be inhibited by Zn(2+), Cu(+), Fe(2+), trichostatin, and other inhibitors.

Mutation analysis by Buggy et al. (2000) showed that 2 adjacent histidine residues in the predicted active site, his142 and his143, are required for HDAC activity on H4 peptide substrates and core histones.

Vannini et al. (2004) found that knockdown of HDAC8 by RNA interference inhibited the growth of human lung, colon, and cervical cancer cell lines.

Deardorff et al. (2012) used RNAi-based screening of all known human histone deacetylases and sirtuins to identify HDAC8 as the vertebrate SMC3 (606062) deacetylase. Loss of HDAC8 activity using either HDAC8 RNAi or an HDAC8-specific inhibitor did not alter cell cycle progression, but clearly increased acetylated SMC3 in both soluble and chromatin fractions throughout the cell cycle. Deardorff et al. (2012) then showed that reduction in HDAC8 led to decreased occupancy of cohesin localization sites.