Sequence 590 (HDV-3 , HDV3)

Sequence HDV-3 , HDV3
Target	AJ307077.1 (Hepatitis delta virus)
Description
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) CGGACCAGATGGAGGTAGATT / siRNA antisense (21b) TCTACCTCCATCTGGTCCGTT
Application	gene silencing
Name	HDV-3 , HDV3

References

Susceptibility of human hepatitis delta virus RNAs to small interfering RNA action.Chang J, Taylor JM.J Virol. 2003 Sep;77(17) :9728-31.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

HDV is considered to be a subviral satellite because it can propagate only in the presence of the hepatitis B virus (HBV) (Makino et al. 1987). Transmission of HDV can occur either via simultaneous infection with HBV (coinfection) or superimposed on chronic hepatitis B or hepatitis B carrier state (superinfection). Both superinfection and coinfection with HDV results in more severe complications compared to infection with HBV alone. These complications include a greater likelihood of experiencing liver failure in acute infections and a rapid progression to liver cirrhosis, with an increased chance of developing liver cancer in chronic infections (Fattovich et al. 2000). In combination with hepatitis B virus, hepatitis D has the highest mortality rate of all the hepatitis infections, at 20%. The HDV is a small, spherical virus with a 36 nm diameter. It has an outer coat containing three HBV envelope proteins (called large, medium, and small hepatitis B surface antigens), and host lipids surrounding an inner nucleocapsid. The nucleocapsid contains single-stranded, circular RNA of 1679 nucleotides and about 200 molecules of hepatitis D antigen (HDAg) for each genome. The central region of HDAg has been shown to bind RNA (Poisson et al. 1993). Several interactions are also mediated by a coiled-coil region at the N terminus of HDAg (Zuccola et al. 1998). The hepatitis D circular genome is unique to animal viruses because of its high GC nucleotide content. The HDV genome exists as an enveloped, negative sense, single-stranded, closed circular RNA. Its nucleotide sequence is 70% self-complementary, allowing the genome to form a partially double-stranded, rod-like RNA structure (Saldanha et al. 1990). With a genome of approximately 1700 nucleotides, HDV is the smallest "virus" known to infect animals. It has been proposed that HDV may have originated from a class of plant pathogens called viroids, which are much smaller than viruses (Elena et al. 1991; Sureau et al. 2006).

The RNA polymerases treat the RNA genome as double stranded DNA due to the folded rod-like structure it is in. Three forms of RNA are made; circular genomic RNA, circular complementary antigenomic RNA, and a linear polyadenylated antigenomic RNA, which is the mRNA containing the open reading frame for the HDAg. Synthesis of antigenomic RNA occurs in the nucleolus, mediated by RNA Pol I, whereas synthesis of genomic RNA takes place in the nucleoplasm, mediated by RNA Pol II (Li et al. 2006). HDV RNA is synthesized first as linear RNA that contains many copies of the genome. The genomic and antigenomic RNA contain a sequence of 85 nucleotides, the Hepatitis delta virus ribozyme, that acts as a ribozyme, which self-cleaves the linear RNA into monomers. These monomers are then ligated to form circular RNA (Branch et al. 1989; Wu et al 1989).