Sequence 604 (M HIF-1a)
| Sequence M HIF-1a | |
|---|---|
| Target | Hif1a ( Mus musculus ) |
| Description | Hypoxia inducible factor 1, alpha subunit
Ensembl: ENSMUSG00000021109 UniGene: Mm.3879 EntrezGene: 15251 Ensembl Chr12: 75002362 - 75048517 Strand: 1 GO terms: 0001525 0001666 0001755 0001892 0001947 0003700 0004871 0005515 0005634 0005737 0006355 0006879 0007165 0009434 0030154 0030528 0030949 0035035 0035162 0042541 0042981 0043619 0045449 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (22b) AAACCAGCAGTTACTCATGCAA / Reverse PCR primer (24b) CATGATCCAGGCTTAACAATTCCA |
| Application | gene expression |
| Name | M HIF-1a |
References
Molecular biomarkers of vascular dysfunction in obstructive sleep apnea.Kaczmarek E, Bakker JP, Clarke DN, Csizmadia E, Kocher O, Veves A, Tecilazich F, O'Donnell CP, Ferran C, Malhotra A.PLoS One. 2013 Jul 29;8(7) :e70559. doi: 10.1371/journal.pone.0070559. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
