Sequence 605 (H HIF-1a)
| Sequence H HIF-1a | |
|---|---|
| Target | HIF1A ( Homo sapiens ) |
| Description | Hypoxia-inducible factor 1, alpha subunit ( basic helix-loop-helix transcription factor )
Ensembl: ENSG00000100644 UniGene: Hs.597216 EntrezGene: 3091 Ensembl Chr14: 61231992 - 61284729 Strand: 1 GO terms: 0001666 0003700 0003705 0004871 0005515 0005634 0005737 0006355 0007165 0030528 0035035 0042592 0045449 0045941 0046982 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (21b) TGCACAGGCCACATTCACGTA / Reverse PCR primer (22b) GTTCACAAATCAGCACCAAGCA |
| Application | gene expression |
| Name | H HIF-1a |
References
Molecular biomarkers of vascular dysfunction in obstructive sleep apnea.Kaczmarek E, Bakker JP, Clarke DN, Csizmadia E, Kocher O, Veves A, Tecilazich F, O'Donnell CP, Ferran C, Malhotra A.PLoS One. 2013 Jul 29;8(7) :e70559. doi: 10.1371/journal.pone.0070559. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
