Sequence 611 (si 006)
From Wikisequences
Sequence si_006 | |
---|---|
Target | HIF1A ( Homo sapiens ) |
Description | Hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Ensembl: ENSG00000100644 UniGene: Hs.597216 EntrezGene: 3091 Ensembl Chr14: 61231992 - 61284729 Strand: 1 GO terms: 0001666 0003700 0003705 0004871 0005515 0005634 0005737 0006355 0007165 0030528 0035035 0042592 0045449 0045941 0046982 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GCAACTGTCATATATAACACC / siRNA antisense (21b) TGTTATATATGACAGTTGCTT |
Application | gene silencing |
Name | si_006 |
References
DSIR: assessing the design of highly potent siRNA by testing a set of cancer-relevant target genes. Filhol O, Ciais D, Lajaunie C, Charbonnier P, Foveau N, Vert JP, Vandenbrouck Y. PLoS One. 2012;7(10):e48057.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478