Sequence 621 (HLA-C)
From Wikisequences
| Sequence HLA-C | |
|---|---|
| Target | HLA-C ( Homo sapiens ) |
| Description | Major histocompatibility complex, class I, C
Ensembl: ENSG00000204525 UniGene: Hs.449621 EntrezGene: 3107 Ensembl Chr6: 31344505 - 31347886 Strand: -1 GO terms: 0002474 0006955 0016020 0016021 0019882 0042612 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (22b) CTCAGATCACCCAGCGCAAGTT / Reverse PCR primer (21b) AGCGTCTCCTTCCCGTTCTCC |
| Application | gene expression |
| Name | HLA-C |
References
Low immunogenicity of neural progenitor cells differentiated from induced pluripotent stem cells derived from less immunogenic somatic cells.Liu P, Chen S, Li X, Qin L, Huang K, Wang L, Huang W, Li S, Jia B, Zhong M, Pan G, Cai J, Pei D.PLoS One. 2013 Jul 26;8(7) :e69617. doi: 10.1371/journal.pone.0069617. Print 2013.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
