Sequence 631 (AUF1 2 , AUF12)
| Sequence AUF1_2 , AUF12 | |
|---|---|
| Target | HNRNPD ( Homo sapiens ) |
| Description | heterogeneous nuclear ribonucleoprotein D
Ensembl: ENSG00000138668 EntrezGene: 5036 Ensembl Chr4: 83493491 - 83514173 Strand: -1 GO terms: 0000166 0000781 0003676 0003677 0003723 0005515 0005634 0005694 0006350 0006355 0006396 0006401 0016563 0030529 0042309 0050825 0050826 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GCAGCGACGGCACAGCGGGTT / siRNA antisense (21b) CCCGCTGTGCCGTCGCTGCTT |
| Application | gene silencing |
| Name | AUF1_2 , AUF12 |
References
Roles of AUF1 isoforms, HuR and BRF1 in ARE-dependent mRNA turnover studied by RNA interference.Raineri I, Wegmueller D, Gross B, Certa U, Moroni C.Nucleic Acids Res. 2004 Feb 19;32(4) :1279-88. Print 2004.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. Wagner et al. (1998) showed that the 4 AUF1 isoforms exhibit an approximately 35-fold range in ARE-binding affinities, with p37AUF having the highest affinity and p40AUF having the lowest affinity.
Cytokine and protooncogene mRNAs are rapidly degraded through AU-rich elements in the 3-prime untranslated region. Rapid decay involves AU-rich binding protein AUF1, which complexes with heat-shock proteins HSC70 (600816) and HSP70 (see 140550), translation initiation factor EIF4G (600495), and poly(A)-binding protein (PABP; 604679). AU-rich mRNA decay is associated with displacement of EIF4G from AUF1, ubiquitination of AUF1, and degradation of AUF1 by proteasomes. Induction of HSP70 by heat shock, downregulation of the ubiquitin-proteasome network, or inactivation of ubiquitinating enzyme E1 (314370), all result in HSP70 sequestration of AUF1 in the perinucleus-nucleus, and all 3 processes block decay of AU-rich mRNAs and AUF1 protein. These results link the rapid degradation of cytokine mRNAs to the ubiquitin-proteasome pathway (Laroia et al., 1999).
AU-rich elements and protein-coding determinants direct rapid removal of poly(A) tails as a necessary first step in mRNA decay. Grosset et al. (2000) determined that 5 proteins form a multiprotein complex associated with the major protein-coding-region determinant of instability (mCRD) of the FOS gene: PABP, HNRNPD, PAIP1 (605184), NSAP1, and UNR (191510). Overexpression of these proteins stabilized mCRD-containing mRNA by impeding deadenylation.
