Sequence 632 (Hormad1)

Sequence Hormad1
Target	HORMAD1 ( Homo sapiens )
Description	HORMA domain containing 1 Ensembl: ENSG00000143452 UniGene: Hs.298312 EntrezGene: 84072 Ensembl Chr1: 148937160 - 148959976 Strand: -1 GO terms: 0005634 0007067
Design	primer set
Chemistry	DNA
Sequence	Forward PCR primer (19b) GCCCAGTTGCAGAGGACTC / Reverse PCR primer (22b) TCTTGTTCCATAAGCGCATTCT
Application	gene expression
Name	Hormad1

References

Low immunogenicity of neural progenitor cells differentiated from induced pluripotent stem cells derived from less immunogenic somatic cells.Liu P, Chen S, Li X, Qin L, Huang K, Wang L, Huang W, Li S, Jia B, Zhong M, Pan G, Cai J, Pei D.PLoS One. 2013 Jul 26;8(7) :e69617. doi: 10.1371/journal.pone.0069617. Print 2013.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background