Sequence 639 (siHSP90AA1.2)
From Wikisequences
| Sequence siHSP90AA1.2 | |
|---|---|
| Target | HSP90AA1 (Homo sapiens) |
| Description | Heat shock protein 90kDa alpha (cytosolic), class A member 1
Ensembl: ENSG00000080824 UniGene: Hs.523560 EntrezGene: 3320 Ensembl Chr14: 101616859 - 101675776 Strand: -1 GO terms: 0000166 0003674 0005524 0005575 0005737 0005829 0006457 0006839 0006950 0006986 0007165 0008150 0030235 0030911 0042026 0042803 0045429 0051082 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) AGAAATAGGTTAAACTGAATT / siRNA antisense (21b) TTCAGTTTAACCTATTTCTAG |
| Application | gene silencing |
| Name | siHSP90AA1.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
