Sequence 654 (IR-ASO , IRASO )
Sequence IR-ASO , IRASO | |
---|---|
Target | IR ( Mus musculus ) |
Description | Insulin receptor
Ensembl: ENSMUSG00000005534 UniGene: Mm.268003 EntrezGene: 16337 Ensembl Chr8: 3155401 - 3279128 Strand: -1 GO terms: 0000166 0004672 0004674 0004713 0004714 0004872 0004918 0005009 0005515 0005524 0005768 0005829 0005886 0006468 0006935 0007169 0008286 0009887 0016020 0016021 0016740 0018108 0019903 |
Design | MOE gapmer |
Chemistry | moT*moT*moC*moT*moT*C*T*C*G*A*T*G*C*G*G*moA*moC*moA*moG*moA |
Sequence | TTCTTCTCGATGCGGACAGA |
Application | gene silencing |
Name | IR-ASO , IRASO |
References
Severe impairment in liver insulin signaling fails to alter hepatic insulin action in conscious mice. Buettner C, Patel R, Muse ED, Bhanot S, Monia BP, McKay R, Obici S, Rossetti L. J Clin Invest. 2005 May;115(5):1306-13.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478