Sequence 656 (shIsl1 5 , shIsl15)
From Wikisequences
Sequence shIsl1_5 , shIsl15 | |
---|---|
Target | ISL1 ( Gallus gallus ) |
Description | ISL LIM homeobox 1 |
Design | shRNA |
Chemistry | RNA |
Sequence | (49b) ATGACTGGCCTCAGTCCGATTCAAGAGATCGGACTGAGGCCAGTCATTT |
Application | gene silencing |
Name | shIsl1_5 , shIsl15 |
References
Plasmid-based short-hairpin RNA interference in the chicken embryo.Chesnutt C, Niswander L.Genesis. 2004 Jun;39(2) :73-8.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478