Sequence 658 (CD11C)
Sequence CD11C | |
---|---|
Target | ITGAX ( Homo sapiens ) |
Description | Integrin, alpha X ( complement component 3 receptor 4 subunit )
Ensembl: ENSG00000102678 UniGene: Hs.248472 EntrezGene: 3687 Ensembl Chr13: 21143875 - 21174187 Strand: 1 GO terms: 0000074 0001525 0001649 0002053 0002062 0005615 0006606 0007165 0007267 0007275 0008083 0008201 0008283 0008543 0008584 0030154 0030178 0030238 0030324 0030326 0030949 0042472 0045743 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GCCCTCCCAGGAACACATATT / siRNA antisense (21b) TATGTGTTCCTGGGAGGGCTT |
Application | gene silencing |
Name | CD11C |
References
Identification of cell surface targets for HIV-1 therapeutics using genetic screens.Dunn SJ, Khan IH, Chan UA, Scearce RL, Melara CL, Paul AM, Sharma V, Bih FY, Holzmayer TA, Luciw PA, Abo A.Virology. 2004 Apr 10;321(2) :260-73.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478