Sequence 679 (K14-1(4), K141(4) )

Sequence K14-1(4), K141(4)
Target	KRT14 ( Homo sapiens )
Description	Keratin 14 ( epidermolysis bullosa simplex, Dowling-Meara, Koebner ) Ensembl: ENSG00000186847 UniGene: Hs.654380 EntrezGene: 3861 Ensembl Chr17: 36992059 - 36996673 Strand: -1 GO terms: 0005198 0005200 0005515 0008544 0030855 0045095
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GGATGCCGAGGAATGGTTCTT / siRNA antisense (21b) GAACCATTCCTCGGCATCCTT
Application	gene silencing
Name	K14-1(4), K141(4)

References

Epidermolysis bullosa simplex-type mutations alter the dynamics of the keratin cytoskeleton and reveal a contribution of actin to the transport of keratin subunits.Werner NS, Windoffer R, Strnad P, Grund C, Leube RE, Magin TM.Mol Biol Cell. 2004 Mar;15(3) :990-1002. Epub 2003 Dec 10.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Clinical Features. Dermatopathia pigmentosa reticularis (DPR) is a rare heritable disorder consisting of a triad of cutaneous findings including reticulate hyperpigmentation, noncicatricial alopecia, and onychodystrophy. Variable features include adermatoglyphia, hypohidrosis or hyperhidrosis, and palmoplantar hyperkeratosis. Heimer et al. (1992) described a family with 9 cases distributed through 6 sibships of 4 generations. The diagnosis was confirmed by the authors in the 30-year-old proband and her son and daughter. In addition to the triad, the proposita had adermatoglyphia, hypohidrosis, and punctate hyperkeratosis of the palms and soles. The family contained no instance of male-to-male transmission. Heimer et al. (1992) presented a figure demonstrating the lack of fingerprint patterns.

Dermatopathia pigmentosa reticularis is closely related to another autosomal dominant ectodermal dysplasia syndrome, Naegeli-Franceschetti-Jadassohn syndrome (NFJS; 161000) (Lugassy et al., 2006). Among the most distinctive characteristics of these syndromes is the complete absence of dermatoglyphics. Other shared features include a reticulate pattern of skin hyperpigmentation, thickening of the palms and soles (palmoplantar keratoderma), abnormal sweating, and other subtle developmental anomalies of the teeth, hair, and skin. DPR has been distinguished from NFJS by lifelong persistence of the skin hyperpigmentation, partial alopecia, and absence of dental anomalies (Heimer et al., 1992).