Sequence 684 (MO let-7 , MOlet7)
From Wikisequences
Sequence MO_let-7 , MOlet7 | |
---|---|
Target | let-7 ( Danio rerio ) |
Description | let7 |
Design | morpholino |
Chemistry | pmApmApmCpmTpmApmTpmApmCpmApmApmCpmCpmTpmApmCpmTpmApmCpmCpmTpmCpmA |
Sequence | (22b) AACTATACAACCTACTACCTCA |
Application | gene silencing |
Name | MO_let-7 , MOlet7 |
References
Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development.Kloosterman WP, Lagendijk AK, Ketting RF, Moulton JD, Plasterk RH.PLoS Biol. 2007 Aug;5(8) :e203.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478