Sequence 687 (leu7g)

Sequence leu7g
Target	leu7g ( Homo sapiens )
Description	leu7g
Design	morpholino
Chemistry	pmApmCpmTpmGpmTpmApmCpmApmApmApmCpmTpmApmCpmTpmApmCpmCpmTpmCpmA
Sequence	(21b) ACTGTACAAACTACTACCTCA
Application	gene silencing
Name	leu7g

References

Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis.Cheng AM, Byrom MW, Shelton J, Ford LP.Nucleic Acids Res. 2005 Mar 1;33(4) :1290-7. Print 2005.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background