Sequence 708 (LMO4 276-mut , LMO4276mut)

Sequence LMO4_276-mut , LMO4276mut
Target	LMO4 ( Homo sapiens )
Description	LIM domain only 4 Ensembl: ENSG00000143013 UniGene: Hs.436792 EntrezGene: 8543 Ensembl Chr1: 87566739 - 87587021 Strand: 1 GO terms: 0001843 0003700 0005667 0006350 0006355 0006366 0008134 0008270 0046872
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GTCCATTTCTCGGCGTTAATT / siRNA antisense (21b) TTAACGCCGAGAAATGGACTT
Application	gene silencing
Name	LMO4_276-mut , LMO4276mut

References

Overexpression of LMO4 induces mammary hyperplasia, promotes cell invasion, and is a predictor of poor outcome in breast cancer.Sum EY, Segara D, Duscio B, Bath ML, Field AS, Sutherland RL, Lindeman GJ, Visvader JE.Proc Natl Acad Sci U S A. 2005 May 24;102(21) :7659-64. Epub 2005 May 16.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Visvader et al. (2001) explored a role for LMO4, initially described as a human breast tumor autoantigen, in developing mammary epithelium and breast oncogenesis. The gene was expressed predominantly in the lobuloalveoli of the mammary gland during pregnancy. Consistent with a role in proliferation, forced expression of this gene inhibited differentiation of mammary epithelial cells. Overexpression of LMO4 mRNA was observed in 5 of 10 human breast cancer cell lines. Moreover, in situ hybridization analysis of 177 primary invasive breast carcinomas revealed overexpression of LMO4 in 56% of specimens. Immunohistochemistry confirmed overexpression in a high percentage (62%) of tumors. These studies implied a role for LMO4 in maintaining proliferation of mammary epithelium and suggested that deregulation of this gene may contribute to breast tumorigenesis.

Using human and mouse expression plasmids in several protein interaction assays, Sum et al. (2002) identified CTIP (604124) and BRCA1 (113705) as LMO4-binding proteins. The LMO4-BRCA1 interaction required the C-terminal BRCT domains of BRCA1. LDB1 also associated with a complex containing LMO4, CTIP, and BRCA1 in transfected human embryonic kidney cells. In functional assays, LMO4 repressed BRCA1-mediated transcriptional activation in both yeast and mammalian cells.

Wittlin et al. (2003) found that the 2 LMO4 promoters exhibited strong activity in breast cancer cell lines that correlated with RNA levels. Promoter 2 appeared to be selectively activated in certain breast cancer cell lines but not in immortalized human mammary epithelial cells, implying aberrant activation of the LMO4 gene in the cancer cell lines.

By mammalian 2-hybrid analysis, Manetopoulos et al. (2003) showed that the helix-loop-helix protein HEN1 (162360) interacted with both LMO2 and LMO4. LMO4, but not LMO2, could augment HEN1-mediated repression of E47 (147141) transcriptional activity. LMO4 could also prevent HEN1-mediated neurite extension in rat hippocampal precursor cells. Manetopoulos et al. (2003) concluded that LMO4 can modulate the transcriptional activity of HEN1.

Sum et al. (2005) found that downregulation of LMO4 expression by RNA interference reduced proliferation of human breast cancer cells and increased differentiation of mouse mammary epithelial cells. Furthermore, transfection of small interfering RNA into breast cancer cells reduced the capacity of the cells to migrate and invade an extracellular matrix. Conversely, overexpression of LMO4 in noninvasive, immortalized human breast epithelial cells promoted cell motility and invasion. Sum et al. (2005) also found that high nuclear levels of LMO4 correlated with poor patient outcome in a cohort of 159 primary breast cancers. They concluded that deregulation of LMO4 in breast epithelium contributes directly to breast neoplasia by altering the rate of cellular proliferation and promoting cell invasion.