Sequence 738 (shMEK2)

Sequence shMEK2
Target	MAP2K2 ( Homo sapiens )
Description	Mitogen-activated protein kinase kinase 2 Ensembl: ENSG00000126934 UniGene: Hs.465627 EntrezGene: 5605 Ensembl Chr19: 4041319 - 4075126 Strand: -1 GO terms: 0000166 0004672 0004674 0004713 0005515 0005524 0005576 0006468 0016740
Design	shRNA
Chemistry	RNA
Sequence	(64b) GATCCCGAAGGAGAGCCTCACAGCATTCAAGAGATGCTGTGAGGCTCTCCTTCTTTTTTGGAAA
Application	gene silencing
Name	shMEK2

References

MEK1 and MEK2, different regulators of the G1/S transition.Ussar S, Voss T.J Biol Chem. 2004 Oct 15;279(42) :43861-9. Epub 2004 Jul 28.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Gene Function. Zheng and Guan (1993) showed that recombinant MEK2 and MEK1 both could activate human ERK1 (601795) in vitro. They further characterized biochemically the 2 MAP2Ks.

A virulence factor from Yersinia pseudotuberculosis, YopJ, is a 33-kD protein that perturbs a multiplicity of signaling pathways. These include inhibition of the extracellular signal-regulated kinase ERK, c-jun NH2-terminal kinase (JNK), and p38 mitogen-activated protein kinase (MAPK) pathways and inhibition of the nuclear factor kappa B (NF-kappa-B; see 164011) pathway. The expression of YopJ has been correlated with the induction of apoptosis by Yersinia. Using a yeast 2-hybrid screen based on a LexA-YopJ fusion protein and a HeLa cDNA library, Orth et al. (1999) identified mammalian binding partners of YopJ. These included the fusion proteins of the GAL4 activation domain with MAPK kinases MKK1 (176872), MKK2, and MKK4/SEK1 (601335). YopJ was found to bind directly to MKKs in vitro, including MKK1, MKK3 (602315), MKK4, and MKK5 (602448). Binding of YopJ to the MKK blocked both phosphorylation and subsequent activation of the MKKs. These results explain the diverse activities of YopJ in inhibiting the ERK, JNK, p38, and NF-kappa-B signaling pathways, preventing cytokine synthesis and promoting apoptosis. YopJ-related proteins that are found in a number of bacterial pathogens of animals and plants may function to block MKKs so that host signaling responses can be modulated upon infection.

Mittal et al. (2006) found that the Yersinia YopJ virulence factor inhibited the host inflammatory response and induced apoptosis of immune cells by catalyzing acetylation of 2 ser residues in the activation loop of MEK2, thereby blocking MEK2 activation and signal propagation. YopJ also caused acetylation of a thr residue in the activation loop of both IKKA (CHUK; 600664) and IKKB (IKBKB; 603258). Mittal et al. (2006) concluded that ser/thr acetylation is a mode of action for bacterial toxins that may also occur under nonpathogenic conditions to regulate protein function. Influenza A viruses are significant causes of morbidity and mortality worldwide. Annually updated vaccines may prevent disease, and antivirals are effective treatment early in disease when symptoms are often nonspecific. Viral replication is supported by intracellular signaling events. Using U0126, a nontoxic inhibitor of MEK1 and MEK2, and thus an inhibitor of the RAF1 (164760)/MEK/ERK pathway (see Favata et al. (1998)), Pleschka et al. (2001) examined the cellular response to infection with influenza A. U0126 suppressed both the early and late ERK activation phases after virus infection. Inhibition of the signaling pathway occurred without impairing the synthesis of viral RNA or protein, or the import of viral ribonucleoprotein complexes (RNP) into the nucleus. Instead, U0126 inhibited RAF/MEK/ERK signaling and the export of viral RNP without affecting the cellular mRNA export pathway. Pleschka et al. (2001) proposed that ERK regulates a cellular factor involved in the viral nuclear export protein function. They suggested that local application of MEK inhibitors may have only minor toxic effects on the host while inhibiting viral replication without giving rise to drug-resistant virus variants.

Scholl et al. (2007) found that conditional deletion of either Mek1 or Mek2 in mouse skin had no effect on epidermal development, but combined Mek1/Mek2 deletion during embryonic development or in adulthood abolished Erk1/Erk2 (MAPK1; 176948) phosphorylation and led to hypoproliferation, apoptosis, skin barrier defects, and death. Conversely, a single copy of either allele was sufficient for normal development. Combined Mek1/Mek2 loss also abolished Raf-induced hyperproliferation. To examine the effect of combined MEK deletion on human skin, Scholl et al. (2007) used small interfering RNA to delete MEK1 and MEK2 expression in normal primary human keratinocytes and used these cells to regenerate human epidermal tissue on human dermis, which was grafted onto immune-deficient mice. Control keratinocytes or those lacking either MEK1 or MEK2 were able to regenerate 6 days after grafting. In contrast, combined depletion of MEK1 and MEK2 led to either graft failure or markedly hypoplastic epidermis that nonetheless contained an intact stratum corneum. ERK2 expression rescued the defect. Scholl et al. (2007) concluded that MEK1 and MEK2 are functionally redundant in the epidermis and function in a linear relay in the MAPK pathway. Animal Model.Belanger et al. (2003) developed Mek2-deficient mice. Mutant mice were viable and fertile and showed no phenotypic abnormalities. Mutant embryonic fibroblasts and purified lymphocytes proliferated normally, demonstrating that Mek2 is not required for reentry into the cell cycle or for T-cell development. Belanger et al. (2003) concluded that MEK1 can compensate for a lack of MEK2 function.