Sequence 748 (p38 33 , p3833)
From Wikisequences
Sequence p38_33 , p3833 | |
---|---|
Target | MAPK12 ( Homo sapiens ) |
Description | Mitogen-activated protein kinase 12
Ensembl: ENSG00000188130 UniGene: Hs.432642 EntrezGene: 6300 Ensembl Chr22: 49033459 - 49042312 Strand: -1 GO terms: 0000166 0000287 0004672 0004674 0004707 0004713 0005515 0005524 0005737 0005739 0006468 0006975 0007049 0007050 0007165 0007517 0016740 0045445 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) GGCATCCATCAGAGCAGACTT / siRNA antisense (21b) GTCTGCTCTGATGGATGCCTT |
Application | gene silencing |
Name | p38_33 , p3833 |
References
The stress kinase MRK contributes to regulation of DNA damage checkpoints through a p38gamma-independent pathway.Tosti E, Waldbaum L, Warshaw G, Gross EA, Ruggieri R.J Biol Chem. 2004 Nov 12;279(46) :47652-60. Epub 2004 Sep 1.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478