Sequence 755 (jnk2)
From Wikisequences
Sequence jnk2 | |
---|---|
Target | MAPK9 ( Homo sapiens ) |
Description | Mitogen-activated protein kinase 9
Ensembl: ENSG00000050748 UniGene: Hs.654461 EntrezGene: 5601 Ensembl Chr5: 179595388 - 179640218 Strand: -1 GO terms: 0000166 0004672 0004674 0004705 0004707 0004713 0005515 0005524 0006468 0006950 0007254 0016740 |
Design | shRNA |
Chemistry | RNA |
Sequence | (64b) GATCCCCGCCGTCCTTTTCAGAACCATTCAAGAGATGGTTCTGAAAAGGACGGCTTTTTGGAAA |
Application | gene silencing |
Name | jnk2 |
References
Sodium 4-phenylbutyrate induces apoptosis of human lung carcinoma cells through activating JNK pathway.Zhang X, Wei L, Yang Y, Yu Q.J Cell Biochem. 2004 Nov 1;93(4) :819-29.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478