Sequence 755 (jnk2)

Sequence jnk2
Target	MAPK9 ( Homo sapiens )
Description	Mitogen-activated protein kinase 9 Ensembl: ENSG00000050748 UniGene: Hs.654461 EntrezGene: 5601 Ensembl Chr5: 179595388 - 179640218 Strand: -1 GO terms: 0000166 0004672 0004674 0004705 0004707 0004713 0005515 0005524 0006468 0006950 0007254 0016740
Design	shRNA
Chemistry	RNA
Sequence	(64b) GATCCCCGCCGTCCTTTTCAGAACCATTCAAGAGATGGTTCTGAAAAGGACGGCTTTTTGGAAA
Application	gene silencing
Name	jnk2

References

Sodium 4-phenylbutyrate induces apoptosis of human lung carcinoma cells through activating JNK pathway.Zhang X, Wei L, Yang Y, Yu Q.J Cell Biochem. 2004 Nov 1;93(4) :819-29.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background