Sequence 756 ()

Sequence
Target	MCL1 ( Homo sapiens )
Description	Myeloid cell leukemia sequence 1 ( BCL2-related ) Ensembl: ENSG00000143384 UniGene: Hs.632486 EntrezGene: 4170 Ensembl Chr1: 148813661 - 148818760 Strand: -1 GO terms: 0001709 0005515 0005634 0005737 0005739 0005741 0006916 0007275 0008632 0015266 0016020 0016021 0019725 0030154 0042981 0046982
Design	shRNA
Chemistry	RNA
Sequence	(49b) GCAGTCCTCTAGTGTTTCATTCAAGAGATGAAACACTAGAGGACTGCTT
Application	gene silencing
Name

References

Evidence for a protective role of Mcl-1 in proteasome inhibitor-induced apoptosis.Nencioni A, Hua F, Dillon CP, Yokoo R, Scheiermann C, Cardone MH, Barbieri E, Rocco I, Garuti A, Wesselborg S, Belka C, Brossart P, Patrone F, Ballestrero A.Blood. 2005 Apr 15;105(8) :3255-62. Epub 2004 Dec 21.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background