Sequence 763 (MEN1-7)
Sequence MEN1-7 | |
---|---|
Target | MEN1 ( Homo sapiens ) |
Description | Multiple endocrine neoplasia I
Ensembl: ENSG00000133895 UniGene: Hs.423348 EntrezGene: 4221 Ensembl Chr11: 64327564 - 64335342 Strand: -1 GO terms: 0000122 0003677 0005515 0005634 0005829 0006355 0016571 0030528 0032154 0035097 0045941 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) AGAAGGTCTCCGATGTCATTT / siRNA antisense (21b) ATGACATCGGAGACCTTCTTT |
Application | gene silencing |
Name | MEN1-7 |
References
Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells.Scacheri PC, Rozenblatt-Rosen O, Caplen NJ, Wolfsberg TG, Umayam L, Lee JC, Hughes CM, Shanmugam KS, Bhattacharjee A, Meyerson M, Collins FS.Proc Natl Acad Sci U S A. 2004 Feb 17;101(7) :1892-7. Epub 2004 Feb 9.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478