Sequence 796 (miR-150 , miR150)
From Wikisequences
Sequence miR-150 , miR150 | |
---|---|
Target | miR-150 ( Homo sapiens ) |
Description | miR150 |
Design | morpholino |
Chemistry | pmCpmApmCpmTpmGpmGpmTpmApmCpmApmApmGpmGpmGpmTpmTpmGpmGpmGpmApmGpmA |
Sequence | (22b) CACTGGTACAAGGGTTGGGAGA |
Application | gene silencing |
Name | miR-150 , miR150 |
References
Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis.Cheng AM, Byrom MW, Shelton J, Ford LP.Nucleic Acids Res. 2005 Mar 1;33(4) :1290-7. Print 2005.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478