Sequence 878 (miR7 , miR7)

Sequence miR7 , miR7
Target	miR7 ( Homo sapiens )
Description	miR7
Design	morpholino
Chemistry	pmApmApmCpmApmApmApmApmTpmCpmApmCpmTpmApmGpmTpmCpmTpmTpmCpmCpmA
Sequence	(21b) AACAAAATCACTAGTCTTCCA
Application	gene silencing
Name	miR7 , miR7

References

Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis.Cheng AM, Byrom MW, Shelton J, Ford LP.Nucleic Acids Res. 2005 Mar 1;33(4) :1290-7. Print 2005.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background