Sequence 883 (miR-95 , miR95)

From Wikisequences
Jump to: navigation, search
Sequence miR-95 , miR95
Target miR-95 ( Homo sapiens )
Description miR95
Design morpholino
Chemistry pmTpmGpmCpmTpmCpmApmApmTpmApmApmApmTpmApmCpmCpmCpmGpmTpmTpmGpmApmA
Sequence (22b) TGCTCAATAAATACCCGTTGAA
Application gene silencing
Name miR-95 , miR95

References

Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis.Cheng AM, Byrom MW, Shelton J, Ford LP.Nucleic Acids Res. 2005 Mar 1;33(4) :1290-7. Print 2005.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders