Sequence 889 (MSH2)

Sequence MSH2
Target	AGFG1 ( Homo sapiens )
Description	MutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) Ensembl: ENSG00000095002 UniGene: Hs.597656 EntrezGene: 4436 Ensembl Chr2: 47483767 - 47563864 Strand: 1 GO terms: 0000166 0000287 0000400 0001701 0003684 0003697 0004422 0005524 0005634 0006119 0006164 0006284 0006298 0006301 0006915 0006928 0007049 0007050 0008340 0010165 0010224 0016446 0016447
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GACCCAGGGGGTGATCAAGTT / siRNA antisense (21b) CTTGATCACCCCCTGGGTCTT
Application	gene silencing
Name	MSH2

References

Functional and physical interactions between ERCC1 and MSH2 complexes for resistance to cis-diamminedichloroplatinum(II)in mammalian cells.Lan L, Hayashi T, Rabeya RM, Nakajima S, Kanno Si, Takao M, Matsunaga T, Yoshino M, Ichikawa M, Riele Ht, Tsuchiya S, Tanaka K, Yasui A.DNA Repair (Amst) . 2004 Feb 3;3(2) :135-43.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. Hereditary nonpolyposis colorectal cancer (HNPCC) is subdivided into (1) Lynch syndrome I, or site-specific colonic cancer, and (2) Lynch syndrome II, or extracolonic cancer, particularly carcinoma of the stomach, endometrium (see 608089), biliary and pancreatic system, and urinary tract (Lynch and Lynch, 1979; Lynch et al., 1985; Mecklin and Jarvinen, 1991). HNPCC disorders show a proclivity to early onset, predominant proximal location of colon cancer, a dominant pattern of inheritance, an excess of multiple primary cancers, and significantly improved survival when compared stage for stage with the American College of Surgeons Audit Series.

Clinical Features. Lynch Syndrome I From findings in the Danish HNPCC Register, Myrhoj et al. (1997) concluded that colorectal cancer in HNPCC behaves differently from colorectal cancer in general. The mean age at diagnosis of primary CRC was 41 years as compared with 70 years for all Danish CRC. In 68%, the colon cancer was located proximal to the splenic flexure as compared with 49% in Danish CRC in general; the numbers for rectal location were 20% for HNPCC as compared with the general experience of 43%. In 7% of HNPCC, more than 1 colorectal cancer was found at the first operation, versus 1% in the general group. Metastatic tendency was less than in sporadic CRC and survival was better.

They emphasized the importance of ascertaining cancer of all anatomic sites as well as noncancer phenotypic stigmata in assessing a family cancer history to allow definition of the specific CRC syndrome concerned.

Parc et al. (2003) analyzed the age at onset and location of each cancer that had affected a series of 348 patients with HNPCC who had mutation in either the MSH2 or MLH1 gene. Tumor histories of these patients were remarkably similar. Ages at first tumor were not correlated within families. Tumors that developed before 30 years of age were all located in the colon or rectum. Cancers developed before 25 years of age in 5% of patients. Colorectal cancer risks were comparable in males and females but delayed in females by 5 to 10 years. Colorectal cancer was the first manifestation of the disease in 89% of affected males but in only 66% of affected females. Endometrial cancer was the first manifestation in 26% of affected females. Based on these findings, Parc et al. (2003) suggested the following: patients with colorectal or endometrial cancer less than 50 years of age should be invited for screening for MSH2 and MLH1 mutations; surveillance of gene carriers should be initiated in early adulthood (i.e., age 18 years), and should not be delayed by the age at onset of the index case; and up to the age of 30 years, surveillance should focus on the colorectum for both sexes.