Sequence 890 (SR-A1)
From Wikisequences
| Sequence SR-A1 | |
|---|---|
| Target | MSR1 ( Homo sapiens ) |
| Description | Macrophage scavenger receptor 1
Ensembl: ENSG00000038945 UniGene: Hs.147635 EntrezGene: 4481 Ensembl Chr8: 16009758 - 16094671 Strand: -1 GO terms: 0004872 0005044 0005319 0005737 0005887 0006817 0006898 0016020 0042953 |
| Design | primer set |
| Chemistry | DNA |
| Sequence | Forward PCR primer (20b) CCAGGGACATGGGAATGCAA / Reverse PCR primer (20b) CCAGTGGGACCTCGATCTCC |
| Application | gene expression |
| Name | SR-A1 |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
