Sequence 891 (RNAc)
| Sequence RNAc | |
|---|---|
| Target | MYO1C ( Homo sapiens ) |
| Description | Myosin IC
Ensembl: ENSG00000197879 UniGene: Hs.286226 EntrezGene: 4641 Ensembl Chr17: 1314875 - 1342745 Strand: -1 GO terms: 0000166 0003774 0003779 0005516 0005524 0005737 0005902 0009925 0016328 0016459 0016461 0017111 0031941 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GGTCCCCATCCTCAAGAGGTT / siRNA antisense (21b) CCTCTTGAGGATGGGGACCTT |
| Application | gene silencing |
| Name | RNAc |
References
Aurora B overexpression associates with the thyroid carcinoma undifferentiated phenotype and is required for thyroid carcinoma cell proliferation.Sorrentino R, Libertini S, Pallante PL, Troncone G, Palombini L, Bavetsias V, Spalletti-Cernia D, Laccetti P, Linardopoulos S, Chieffi P, Fusco A, Portella G.J Clin Endocrinol Metab. 2005 Feb;90(2) :928-35. Epub 2004 Nov 23.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. MYO1C, also known as myosin I-beta and MYR2, was thought to mediate the slow component of adaptation by hair cells, the sensory cells of the inner ear. To test this hypothesis, Holt et al. (2002) mutated tyr61 of MYO1C to gly, conferring susceptibility to inhibition by N6-modified ADP analogs. They expressed the mutant MYO1C in utricular hair cells of transgenic mice, delivered an ADP analog through a whole-cell recording pipette, and found that the analog rapidly blocked adaptation to positive and negative deflections in transgenic cells but not in wildtype cells. The speed and specificity of inhibition suggested that MYO1C participates in adaptation in hair cells.
Bose et al. (2002) reported that the unconventional myosin MYO1C is present in GLUT4 (138190)-containing vesicles purified from 3T3-L1 adipocytes. MYO1C is highly expressed in primary and cultured adipocytes. Insulin (176730) enhances the localization of MYO1C with GLUT4 in cortical tubulovesicular structures associated with actin filaments, and this colocalization is insensitive to wortmannin. Insulin-stimulated translocation of GLUT4 to the adipocyte plasma membrane is augmented by the expression of wildtype MYO1C and inhibited by a dominant-negative cargo domain of MYO1C. A decrease in the expression of endogenous MYO1C mediated by small interfering RNAs inhibited insulin-stimulated uptake of 2-deoxyglucose. Thus, Bose et al. (2002) concluded that MYO1C functions in a phosphatidylinositol-3-hydroxykinase (PI3K; see 601232)-independent insulin signaling pathway that controls the movement of intracellular GLUT4-containing vesicles to the plasma membrane.
