Sequence 899 (hCAP-D2(RD2-2) , hCAPD2(RD22) )
From Wikisequences
| Sequence hCAP-D2(RD2-2) , hCAPD2(RD22) | |
|---|---|
| Target | NCAPD2 ( Homo sapiens ) |
| Description | Non-SMC condensin I complex, subunit D2
Ensembl: ENSG00000010292 UniGene: Hs.5719 EntrezGene: 9918 Ensembl Chr12: 6472806 - 6511381 Strand: 1 GO terms: 0000793 0000797 0005634 0005737 0007049 0007067 0007076 0030261 0042393 0045120 0051301 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GAAGATACTCTGGAATTCCTT / siRNA antisense (21b) GGAATTCCAGAGTATCTTCTT |
| Application | gene silencing |
| Name | hCAP-D2(RD2-2) , hCAPD2(RD22) |
References
Spatial and temporal regulation of Condensins I and II in mitotic chromosome assembly in human cells.Ono T, Fang Y, Spector DL, Hirano T.Mol Biol Cell. 2004 Jul;15(7) :3296-308. Epub 2004 May 14.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
