Sequence 900 (hCAP-D3 (RD3-1) , hCAPD3 (RD31) )
From Wikisequences
| Sequence hCAP-D3 (RD3-1) , hCAPD3 (RD31) | |
|---|---|
| Target | NCAPD3 ( Homo sapiens ) |
| Description | Non-SMC condensin II complex, subunit D3
Ensembl: ENSG00000151503 UniGene: Hs.438550 EntrezGene: 23310 Ensembl Chr11: 133527547 - 133599636 Strand: -1 GO terms: 0000799 0005634 0007049 0007067 0007076 0051301 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CTGGATTTCACAGAGACTGTT / siRNA antisense (21b) CAGTCTCTGTGAAATCCAGTT |
| Application | gene silencing |
| Name | hCAP-D3 (RD3-1) , hCAPD3 (RD31) |
References
Spatial and temporal regulation of Condensins I and II in mitotic chromosome assembly in human cells.Ono T, Fang Y, Spector DL, Hirano T.Mol Biol Cell. 2004 Jul;15(7) :3296-308. Epub 2004 May 14.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
