Sequence 907 (hCAP-H (RH-2) , hCAPH (RH2) )
| Sequence hCAP-H (RH-2) , hCAPH (RH2) | |
|---|---|
| Target | NCAPH ( Homo sapiens ) |
| Description | Non-SMC condensin I complex, subunit H
Ensembl: ENSG00000121152 UniGene: Hs.308045 EntrezGene: 23397 Ensembl Chr2: 96365211 - 96405001 Strand: 1 GO terms: 0000278 0005634 0005737 0007067 0007076 0051301 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) CATTACTCCACCTGTATCATT / siRNA antisense (21b) TGATACAGGTGGAGTAATGTT |
| Application | gene silencing |
| Name | hCAP-H (RH-2) , hCAPH (RH2) |
References
Spatial and temporal regulation of Condensins I and II in mitotic chromosome assembly in human cells.Ono T, Fang Y, Spector DL, Hirano T.Mol Biol Cell. 2004 Jul;15(7) :3296-308. Epub 2004 May 14.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
Gene Function. Aono et al. (2002) reported that Cnd2, the fission yeast homolog of Drosophila barren and the budding yeast protein Brn1, is required for both interphase and mitotic condensation. In Cnd2 mutants, ultraviolet-induced DNA damage was not repaired and cells arrested by hydroxyurea did not recover. Cds1 (604373) activation was abolished in the presence of hydroxyurea in Cnd2 mutant cells and in cells where other condensin subunits had been disrupted. In the absence of hydroxyurea, a G2 checkpoint delay occurred in Cnd2 mutants in a manner dependent on Cds1 and Rad3 but not Chk1 (603078), before the mitotic condensation defect. Furthermore, the Cnd2 mutation was synthetic-lethal with mutations of excision repair, RecQ helicase (see 600537), and DNA replication enzymes.
